Frontiers in Physiology | |
Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana | |
Bernard Duvic1  Azza M. Elgendy2  Makio Takeda2  Amr A. Mohamed3  Muhammad Tufail4  | |
[1] DGIMI, Univ Montpellier, INRAE, Montpellier, France;Department of Agrobioscience, Graduate School of Agricultural Science, Kobe University, Hyogo, Japan;Department of Entomology, Faculty of Science, Cairo University, Giza, Egypt;Ghazi University, Dera Ghazi Khan, Punjab, Pakistan; | |
关键词: vitellogenesis; juvenile hormone; 20-hydroxyecdysone; cis-regulatory elements; hemimetabola; periplaneta; | |
DOI : 10.3389/fphys.2021.723072 | |
来源: DOAJ |
【 摘 要 】
Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.
【 授权许可】
Unknown