A new regulatory mechanism for bacterial lipoic acid synthesis

MicrobiologyOpen

Huimin Zhang¹  Qixia Luo²  Haichun Gao² 

[1] Center for Infection and Immunity, Department of Medical Microbiology and Parasitology, School of Basic Medical Sciences, Zhejiang University, Hangzhou, Zhejiang, China;Institute of Microbiology, College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang, China

关键词: cAMP‐receptor protein (CRP);    LipA;    LipB;    Lipoic acid;    lipoic acid synthesis;    Shewanella;   

DOI  :  10.1002/mbo3.237

来源: Wiley

【 摘 要 】

Abstract

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

【 授权许可】

CC BY   
© 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.